Somewhere along the way, before I knew who Richard Dawkins was, I read that Douglas Adams‘s favourite book, The Blind Watchmaker, was written by him. A few years later I heard him mentioned in a university course on Human Evolution. Gradually I found out what this guy was about and realised that he believed and adamantly argued for many of the things that I believe I might believe.
I figured if I wanted to be able to articulate my own atheism in any coherent way, reading Richard Dawkins would be a great way to start. I don’t just want to be able to repeat his arguments, of course, since, although I say I’m an atheist, that’s only the short and easy answer. The real one involves postulating God in a particular cosmological context and concluding that you can’t trust anything he might say even if he did exist, so what’s the point in worshipping him?
At the same time that I was reaching the conclusion that I should read The Blind Watchmaker, I encountered a couple independent groups of people who recommended that I read Darwin’s Black Box by Michael Behe, which examines problems in evolution from a biochemical perspective.
I figured that it would be rather biased if I only read Dawkins to reinforce my own atheism, so for Christmas I asked for both books. I haven’t started reading either consistently yet, but I like being able to look at both aspects of the problem and consider them both in their own right. Atheist though I may be, I have nothing against a sound, well formed argument opposing it.
Many arguments against atheism, however, are far from that. Take for example the Atlas of Creation by Harun Yahya. Just in the summary there is enough to tell me that the book is complete nonsense. It’s not uncommon to hear that the fossil record can’t be trusted, but this book is about taking fossils which are millions of years old, comparing them to currently living species, and then concluding that since some species are essentially unchanged evolution must never have happened. Presumably the countless other fossils which do show evolution are still fake, since if even one species hasn’t changed in a few million years none of them could have.
Needless to say, I’m not going to be asking for Atlas of Creation for Christmas any time soon.






I think the way to demolish a philosophy is to invalidate its foundations one by one through evidence and proofs. Harun Yahya is utilizing this technique and is so successful in that so that his book is cencored. If he is wrong in his ideas there should have been scientific proofs to invalidate him. Cambrian explosion, complexity and harmony of parts working together in a cell, millions of fossills belonging to stable species all with complete systems, absence of intermediate forms.. all lead to the fact of creation and the collapse of the theory of evolution.
The argument seems to be something along the lines of “Some species do not evovle. Therefore, all species do not evolve.” The conclusion does not follow from the premis, and even the premis that some species do not evolve is not shown to be true by Atlas of Creation since the fossil record can only show that there is no record of its evolution. Nobody claims that the fossil record is complete. Absence of evidence is not evidence of absence!
No professional Darwinist would claim that the fossil record is “incomplete” and still there is hope that in future intermediate forms would be found.
Famous paleontologist T. Neville George admits that fact: There is no need to apologize any longer for the poverty of the fossil record. In some ways it has become almost unmanageably rich and discovery is outpacing integration… The fossil record nevertheless continues to be composed mainly of gaps.” (Fossils in Evolutionary Perspective, Science Progress, vol. 48, January 1960, pp. 1, 3.)
Another prominent Darwinist figure S.J. Gould tells that: ”
The history of most fossil species include two features particularly
inconsistent with gradualism:
1) STASIS; most species exhibit no directional change during their
tenure on earth. They appear in the fossil record looking much the
same as when they disappear; morphological change is usually
limited and directionless;
2) SUDDEN APPEARANCE; in any local area, a species does not arise
gradually by the steady transformation of its ancestors; it appears
all at once and ‘fully formed’.
(S.J. Gould, “Evolution’s Erratic Pace”, Natural History, vol. 86, May 1977.)
There is lot more to say on the completeness of the fossil record and the absence of any evidence for evolution. You better get correct and detailed information here: http://www.harunyahya.com/books/darwinism/atlas_creation/atlas_creation_01.php
You contradict yourself. It is impossible to say that the fossil record is both complete and full of gaps. It can have gaps and still be a wealth of information, as George says, but this is not the same as being complete.
It is interesting that it is so often claimed that there are no “intermediate forms” found. Look at the ancestry of humans (which is, I know, probably the last species you want to admit evolved). It is exceedingly difficult to say exactly what specimen is homo sapien and what is not. I’ve studied these fossils and you can see the gradual change just by looking at them. As you go further back in time and fossils are harder to come by, it is more difficult, but where we have a more continuous sample it is obvious. It is only the discrete nomenclature we impose upon them that makes it sound otherwise.
Gould’s statements from “Evolution’s Erratic Pace” are not made to refute evolution, but rather to modify it. Here he is arguing for punctuated equilibrium, which is fully consistent with evolution, not creation.
I’ve read the page you refer to—it was what inspired me to write this post in the first place.
The absence of something never proves anything !
The absence of something never proves anything. That is true, but you should also apply this theory to the “evolution” point of view where there is no evidence for the theory they claim. In other words, the evolutionists are trying to prove the theory by the total absence of proof. Whenever they are asked about any proof they will refer you to the “upcoming” “future” discoveries and they are holding to their theory as “cash”. I think this is not scientific at all. Also, the evolutionists are trying to put themselves as “victims”. They are portraying themselves as victims of “lack of evidence” even though their theory is a very strong one (according to their sayings). The evolutionists are trying to give us the impression that they are like a hard-working, incorruptible and fully independent prosecutor trying to put in jail a well-known criminal but he can’t find any evidence. The criminal in this case is the evolution theory. I think that this is all false and I look at most of evolutionists as unprofessional, close-minded prosecutors trying to frame an innocent victim. The victim in this case is still the evolution theory that never happened. I also think that the real scientific needs to start with unbiased mind and not start as an evolutionist looking for “his” truth. A real scientific will never defend an unfounded theory as the evolutionists do!!!!!
On what basis do you say there’s no evidence for evolution? If there was no evidence for it the idea would have been thrown out a long time ago in favour of something else. (Historically the opposite happened — creation was thrown out in favour of evolution.) Some of the details are missing, yes, but the general mechanisms are no mystery. To say there’s no evidence means you must reject the fossil records showing change over time, genetic mutations (which you can see do happen in a first year biology lab), and the like. There may be cases when there’s no signs of change over long periods of time, which is what Atlas of Creation shows, but it does not follow from that either that the thing never changed, or that nothing changes.
I think that the evolution theory is based on assumptions more than proofs. I’m wondering why the actual ape didn’t mutate as evolutionists claim…. also, no other “intermediate” specie between human and ape survived??? What survived is only the first and the last “versions” of human…that is really weird….Also, why the actual human beings didn’t mutate to produce a better version (we are more than 6 billions on earth and we have a birth each second….so you can see how much opportunities we have to “mutate”….but instead we are still the same and any little “mutation” produces only disasters to human kind (nuclear radiation effect on babies for example)).
Can you tell me what did you see in your first year biology lab? (please be accurate on what you will say). If Darwin was among us and read and studied genetics as it is available today, he will be the first to discredit his theory. I think evolutionists are more “Darwinist” than Darwin himself!!!
If you study genetics and DNA you will find that human DNA for example is composed of 3 billions elements (Cytosine, Guanine, Thumine and Adenine (CGTA)) structured in a very accurate way. For example in the human DNA the 3billions elements (repetitions of the 4 main elements) can be written as CGTATAGCTCGACGTATGACCAGT…..Scientists took more than 15 years to decode the human genome and produce the 3 billions sequence of such elements. They also showed that any change in the position of any letter would bring harm to the individual. The probability of having such a sequence (3 billions) by “chance” is close to zero if not 0….So, basing evolution theory on “mutation” and “chance” is no longer valid.
“I’m wondering why the actual ape didn’t mutate as evolutionists claim”
The other great apes have been evolving along with us. It’s only an approximation to liken our ancestors to chimps, but nobody says that our ancestors *were* chimps. It certainly is not true to say that chimps and humans are respectively the “first and last” versions of our species. It’d be like saying that you make bread out of cookies, when it reality they both come from the common ancestor of flour.
“Also, why the actual human beings didn’t mutate to produce a better version”
Well, in a few billion years I think the single cell bacterium (or whatever it was we started off) did a pretty good job of mutating into something “better”. Now you contradict yourself by saying we have had 6 billion years to mutate and yet we’re still the same. You’re right—we have had several (more like 3 or 4) billion years to mutate, and we have been mutated, which is exactly why we are not the same as life was back then! My argument would be, if God created us in an instant a few thousand years ago, why didn’t he produce a better version? Well, it’s physically impossible for chimpanzees to choke to death—maybe they’re the perfect version. Or squids—they don’t have a blind spot like we do. I think it’d be cool to be a squid.
“Can you tell me what did you see in your first year biology lab?”
The lab project was to view the effects of ultraviolet radiation on bacteria. It was not strictly “natural” selection since we were exposing the bacteria to very high levels of radiation, but the same process happens at a much slower rate by ultraviolet radiation from the sun. Exposed to radiation, the bacteria mutated in various ways, the colonies growing in different colours and morphologies. Bacteria and viruses mutate all the time like that in the wild, from all sorts of different sources (not just UV radiation).
“The probability of having such a sequence (3 billions) by “chance” is close to zero if not 0″
It is true that given a big vat of nucleotides (not “elements”, as you call them), the changes of them spontaneously combining into a strain of human DNA is nil. However, this is NOT what evolution claims happened. There is nothing random about natural selection. The processes that created this complicated system were gradual and cumulative. This makes a BIG difference in how likely something is.
“They also showed that any change in the position of any letter would bring harm to the individual”
This is not true at all. Again, this is first year biology material. Many mutations have no effects on an organism’s phenotype at all. Part of this is redundancy in the DNA code — ACC, ACA, and ACG all code the amino acid Threonine, for example. Changing the last C to a G doesn’t change the resulting protein. This is just one example to show that benign mutations do occur. Changing a letter might change a protein in a minor way. Maybe a regulatory gene will become a little more liberal or a little more lax because of a change in a few amino acids. All hell could break loose on a section of DNA that doesn’t code for anything and nobody would notice. Mutations happen all the time — 1 in 20 of us do not have the same DNA today that we were born with because of them. Most mutation don’t change anything, many will be harmful, but the rare few that are beneficial can survive and drive evolution.
In one of my comments I said “(we are more than 6 billions on earth and we have a birth each second….so you can see how much opportunities we have to “mutate”…. I meant here that we are more than 6 billions people living on earth and that if any evolution was going to happen it should have happened long time ago because of this large number of people living and giving birth each second…In other words, the evolution that took millions of years to happen with only few people on earth should take less time to occur with billions of people now.
Also, in your last sentence you said “but the rare few that are beneficial can survive and drive evolution”. So you are giving a “driving” and a “willing” characteristics to some thing that doesn’t think or reflect. It is like if I’m telling you that I left a piece of wood under the sun and when I came few years later I found that the piece of wood moved to the shadow under a close tree!!!! I then explained to you that the piece of wood got very hot, “felt” the need to go under a shadow and then did over all this years.
For GP.
In your last comments you said : “There is nothing random about natural selection. The processes that created this complicated system were gradual and cumulative. This makes a BIG difference in how likely something is.” Could you please be more specific about “natural selection”? The concept of “natural selection” was so much distorted and given dimensions that it can’t bear. “Natural selection” very simply means that the “weak” elements will “go” and leave the space for the “stronger”. This is a basic concept of competition. However, the fact that the “weak” leaves doesn’t mean that “stronger” species will be generated… Collin Patterson, the senior paleontologist of the British museum said “No one ever produced a species by mechanisms of natural selection”. Let’s give an example: In a deer herd under the threat of wild animals, naturally those that can run faster will survive. That is true. But no matter how long this process goes on, it will not transform those deer into another living species. The deer will always remain deer.
ROFL.
“…I’m an atheist, that’s only the short and easy answer.”
then
“…I’m not going to be asking for Atlas of Creation for CHRISTMAS any time soon.”
Fucking hilarious.
I don’t believe in evolution for epistemological reasons. How did creatures evolve the means to perform actions previously unknown to them? Animals build their nests and such by instinct now, but where was the first instinct? How is it that that instinct but not others pass on? How did complex microbiological functions evolve? The idea of a self-driving force in life is a bit awkward, I mean, how did evolution evolve in the first place? Why isn’t there platonicism?
Michael —
Just because I’m an atheist doesn’t mean I don’t appreciate a good holiday! But for the record I’m totally in favour of secularising Christmas.
One of the beauties about evolution is that it requires no special mechanism to operate. Evolution doesn’t need to evolve. If anything has the capability of reproducing itself, then more copies of itself will be made. (And don’t ask “how does something get the ability to reproduce in the first place”— plenty of non-living things in nature do it. Anything that crystallises is a good example.) And, if out of two things one is slightly better at reproducing than the other, then that one will become more common than the other and may even end up completely replacing the other. Dawkins describes how this can happen with clay as a possible precursor to life. I’d quote him or give the real reference, but I don’t have the book with me.
How did we ever learn to write and comment on blogs, if there were no blogs fifty years ago? People learn new things as necessary. Learning a new technology is much different from developing instinct, of course, but things can be learned. Picture a flock of birds laying their eggs willy nilly all over the place. Clearly eggs in certain areas, like a tree branch or a hard piece of ground, are going to break, and others are going to be more likely to hatch. Birds with stupid ideas about where to put their eggs will tend to die off, since they have fewer offspring. The ones who choose soft ground or cozy alcoves will survive. And some might like to move branches and such around to make safer spots. Nobody has to teach them to do this—its just that the ones who do, just for fun or out of boredom or what have you, will be more successful at breeding. Animals do weird things all the time (my dog always eats his bone on the welcome mat at our back door and nowhere else) and once in a while those weird things turn out to help in making babies.
Complex microbiological functions are the same. Ones which work work, the ones that don’t don’t. They start off simple and changes happen, some bad and others beneficial. The beneficial (and perhaps slightly more complex) version lives on.
Lakrae —
Natural selection works because some will reproduce and others will not. It doesn’t matter how many people are reproducing at any given time, you still need to wait a generation before you get the next batch of people/animals/whatever to operate on.
The moon drives the tides. Temperature differences drive the weather. Beneficial mutations drive evolution. The word “drive” does not require consicous action, or really any active intervention at all.
You’re right that the weak dying off will not guarantee that stronger will take their place. If all members of a species are “weak” and can’t manage to reproduce, the species will die off. But, beneficial mutations and changes do happen, and when they do they hold and the old version (now comparitively weak) does die off. There’s no problem here.
GP, suppose these theories were a species of some sort:
I guess your species (theory) has mutated a long time ago my friend. Its a weak species, and so I guess Creation is stronger.
Creation is PROVING to be the stronger species becasue from you tend to say here, it is ‘evolving’ into Fact. Therefore the Theory of Evolution is the weaker of the ‘Theory species’…. I see you evolved a leg on your back -Stop kicking yourself in the ass!
When the very first so called evolved species came about, like you say it happens all of a sudden in Full Form, what do you think the rest of the herd or group of that species thought to themselves? – If previous species were so weak or not good enough, dont you think they would have killed the wierdo that just popped out of their mother’s tummy or wherever? – Try this out, I urge YOU especially to try this:
Take a new born baby, and place it between the legs of a monkey that is giving birth, without that monkey knowing that you swapped her baby with a human baby… then Eeven if the monkey accepts this… abomination of a baby monkey, who do you think will live longer? (Please let him choose the monkey for his own sake) But isn’t the human suppose to be the better species?
The other thing is, if there was only one proper fully formed human being that was born from one of you monkey looking ancestors species, the poor guy probably died before the next person decided to appear on Earth. The evolved species that you think of, would not have survived a week in the earth. especially with all the wild animals that he might have been surrounded by.
STOP SWINGING THAT EVOLVED BACK LEG OF YOURS GAP!!!!!
Irfaan, you’re talking complete nonsense. Your first three paragraphs don’t make any sense. There’s no basis for saying “Creation” guarantees stronger (more fit to survive) species than evolution.
I have never said that species appear “all of a sudden in Full Form”. There is no such thing as a fully formed species. There is no such thing as one species spontaneously giving birth to a completely new one. No evolutionist on the planet would say that somewhere along the line a monkey must have given birth to a human. If that’s what you think then you haven’t even made an effort to understand.
2) SUDDEN APPEARANCE; in any local area, a species does not arise
gradually by the steady transformation of its ancestors; it appears
all at once and ‘fully formed’.
Whether they appear fully formed or whatever… About the first 3 paragraphs, it wasn’t suppose to make sense.
Creation is not suppose to guarantee better and stringer. God does not create so that things can be better and stronger than each other. Everything created is perfect and unique in its own way and for its purpose. You see the problem here with trying to explain all this to you is that you don’t seem to beleive God Alone, The Alimighty. Without this aspect you cannot make sense of anything.
What’s wrong with apes? If you took the time to understand properly then you’ll find that the Ape is extremely perfect in terms of how it lives and survives etc. there is no need for any of the apes to evolve into anything else, they are quite adapted to their natural environments. If they were truly the weaker species then why haven’t they evolved further and become extinct ?
didn’t you ever think why is that out of all the magnificent creatures inhabitting this Earth, Mankind rules, so to speak? Because we were given this status… think about it. If any of the more dominant species on this planet had the faculties of thought and reason and look then at how structured they are in their day to day activities etc. Who then do you think would have dominated this Earth? – For example thers a movie that has a pitch that a Maco Shark could think, this entire movie the actors were minipulated and driven by this shark, in other words the shark ruled and they couldn’t defend or defeat the shark… that doesn’t happen in the real world cos sharks don’t have free will like we do. – anyway do you get the point? The only reason that shark could think the way it did is becuase the scientests in the movie gave the shark this faculty. – God Alone gave us these faculties as well and more, therefore we didn’t dies off or become exticnt. Adam knew that he had to hunt, he knew what to eat and what not to eat, not by trial and error.
Also, in the movie Little nicky with Adam Sandler being sent to Earth from Hell, one of the funniest moments on that movie was when he just arrived on Earth and got knocked head on by a train, this is what would have happened to the first ‘Evolved’ person that came about… if man evolved and survived in t his way, then I say that survival would have been probably cos the other animals or forms of life just got bored of killing these helpeless creatures all the time cos its too easy.
The thing is that somewhere along YOUR lines there had to have been this abnormal species being born out of the Main species of Apes, like in my first three paragraphs… Whenever it happened or however you imagine it would have happened, the fact remains that the being was EXPOSED to a lot of danger when he arrived and would not have survived to make it this far if it happened that way.
Well with an attitude like that there’s not going to be anything I can say to convince you. You’re making a simple fallacy. There’s nothing interesting about the fact that animal’s are fairly well adapted to their environments. It’s not because they’re designed for that, it’s because those are the environments that they’re adapted through evolution to survive in. You might as well to say there’s no need to put any ingredients or time into baking a cake since once you have a cake it has already been baked.
If you have a cake – then it is indeed baked. I never saw or tasted an unbaked cake. And if you look at a cake, it takes a bit of knowledge to create the cake. You have specific ingredients that make it up… the cake doesn’t simply appear out thin air or by chance… and in order to make the same cake again, the Baker would then take the same ingredients and mix them up etc. until we have another cake, the different types of cakes come from different ingriedients being added here and there to change taste, color and smell etc. – but the fact remains that the cake doesnn’t evolve into different cakes.
C’mon boss… don’t you think you have to admit that evolution doesn’t make sense no matter which way you try to bend it.
The point is not that baking a cake is like evolving, it’s that just because something is in a particular state now does not me mean that it has always been in that state. If you must push the idea, all the ingredients and baking that go into it are time, ancestral species, mutation, and natural selection. Of course cakes don’t appear out of thing air—but neither do species! People tend to think that since everything we know outside of nature was made by man, that everything in the natural world must have been made by somebody too. That’s not a sound logcal conclusion in my book.
The arguments against evolution made above have already been adequately refuted by GP. I’d like to add this:
Creationism is not a scientific theory. Theories can be proven false, and then they are modified or discarded altogether. But creation depends on a God that can do anything. Thus, no matter the evidence against creation, its adherents can always say, “God did it.” With an omnipotent being in your worldview, proof is irrelevant. God could have created the illusion of a fossil record for us, as a test of our faith in him. It is impossible to prove creation wrong because creation requires no proof, it only needs faith.
With this in mind, the creation versus evolution debate looses meaning. Evolution is a product of rational inquiry that gives us a deeper understanding of the way life works. Creation is a one word answer (God) that reveals nothing, and leads nowhere.
GP and ART as well as you Mr. Douglas Adams:
You further confirmed that God created everything! The fact that a man can look around at the world and realise that the world had to have been created by an Omnipotent Being is rational thinking at its best.
Everything around us that exists are signs of God Alone, The Almighty.
‘ Then which of the Favours of your Lord will you deny? ‘
- AL-Quran, Chapter:55
The problem with the evolutionists is that they do not want to admit that there “theory” lacks any scientific or rational evidence, even
deep inside them they know that but often they claim that their collapsing “theory” is scientific but always they avoid answering very legitimate rational
questions about the “theory” for the simple reason: no proof, not even a single scientific evidence, show us a single living being with a complete
evolutionary “links” and use all of your texts and resources that you have, this question has been there unanswered for more than 150 years
despite all the efforts and the advances in the paleontology, actually the fossil discoveries are continuously and increasingly embarrassing the evolutionists, because they always show fully functioning creatures/organs working fully and perfectly, no gradually developed organ or creature has ever been discovered, so the “evolution theory” is simply based on a dogma always avoiding rational thinking, do the evolutionists have a rational answer
to the fact that most (if not all) the organs of any living being have irreducible complexity: what comes to your mind first when you hear the word ‘eye’? Are you aware that one of the most crucial things in life for you is your ability to see? Even if you are, have you ever thought what other signs your eye bears?
The eye is one of the most manifest pieces of evidence that living creatures are created. All sight organs, including animal eyes and the human eye, are extremely striking examples of a perfect design. This exceptional organ is so overwhelmingly complex that it surpasses even the most sophisticated devices in the world.
In order for an eye to see, all of its parts have to co-exist and work in harmony. For instance, if an eye happened to have lost its eyelid, but still had all the other parts such as the cornea, conjunctiva, iris, pupil, eye lenses, retina, choroid, eye muscles, and tear glands, it would still be greatly damaged and soon lose its seeing function. In the same manner, even if all its organelles were present, if the tear production were stopped, the eye would soon dry out and become blind.
‘The chain of coincidences’ posited by evolutionists loses all its meaning against the complex structure of the eye. It is not possible to explain the existence of the eye other than as a matter of special creation. The eye has a multi-sectioned complex system and, as discussed above, all of these individual sections had to come into existence at the same time. It is impossible for a half-developed eye to function at ‘half capacity’. In such a circumstance, the act of seeing can by no means take place. An evolutionist scientist admits to this truth:
The common trait of the eyes and the wings is that they can only function if they are fully developed. In other words, a halfway-developed eye cannot see; a bird with half-formed wings cannot fly
In this case, we again face that very important question: who created all of the components of the eye all at once?
Even if all the evolutionists join forces and try to defend to their false dogma (or actually faith because it lacks any scientific evidence) they can not answer these questions, I studied their theory for long time it all depends on assumptions and guesses not even a single (even a weak) evidence, evolutionists will never be able to save their collapsing theory for the simple reason that it is not scientific because it is lacking any scientific evidence after more than 150 years of of diligent search. Rational thinking tells us that we did not come from nothing, we did not create ourselves, the universe itself did not come from nothing nor we created the universe, so there must be a creator, the most adamant evolutionists failed to answer these questions, sooner or later this so called ‘evolution theory” will be dismissed it is a matter of time to any rational thinking person
I have a cat at home, seems to be away from the subject but just let me finish. The way my cat hears, snicks and run is all the time impressing me. And whenever I saw her I ask myself: did I evolve from a such beautiful and skilled creature…if yes, why didn’t I keep these all these skills???? The same thing applies for the ape who is much stronger and more skilled than a man without a brain…. don’t tell me that we traded the skills for a brain…this is not going to work in an “evolution” theory….
Also, I just learned that the “evolution” “scientists” were striving to explain how a the wale (mammal) came back to leave in the water. The latest explanation they could find is that it evolved from a dog!!!! The previous explanation was that it evolved from a polar bear!!!! Since they found a huge difference between the wale and the polar bears, they turned than to a “closer” animal to find the “dog”.
For GP:
If we consider your theory where “boredom” can lead to some very interesting “evolution” “revolution” in a specie, I find it very hard to understand how a bored fish can evolve to a dolphin who has an ultrasound detector that even the US marines corps was unable to duplicate or develop a close technology to it…. the same thing applies to the bat and many other animals with very sophisticated systems….I think you need more than “boredom” and “random mutations” to convince me of that.
For Art:
If you don’t believe in creation you don’t need to believe in absurd stuff like “evolution”. If someone tells you that he left 3 bricks on the ground and when he came back 2 years later he found them one on top of the other. When you asked him who did so, he will tell you that this happened by chance…are you going to believe him??? Of course NO. But the “evolutionists” want us to believe that things happened in the right sequence, with no discrepancy and with all required intelligence just by “chance”. If they just told us that someone, that they don’t know, did it I will believe them more.
For GP:
To prove that you are an open-minded scientist looking for the truth, you should read the Atlas of creation (it is free online). Be courageous and don’t be afraid of the truth….you should be happy to find it wherever it lays.
“I would rather believe in fairy tales than in such wild speculation. I have said for years that speculations about the origin of life lead to no useful purpose as even the simplest living system is far too complex to be understood in terms of the extremely primitive chemistry scientists have used in their attempts to explain the unexplainable. God cannot be explained away by such naive thoughts.”
–Sir Ernst B. Chain, Nobel Laureate (Medicine, 1945), as quoted by Ronald W. Clark, The Life of Ernst Chain (London: Weidenfield & Nicolson, 1985), pp. 147-148.
“Evolutionism is a fairy tale for grown-ups. This theory has helped nothing in the progress of science. It is useless.”
-Professor Louis Bounoure, past president of the Biological Society of Strassbourg, Director of the Strassbourg Zoological Museum, Director of Research at the French National Center of Scientific Research. (Quoted in The Advocate, March 8, 1984.)
“Biologists are simply naive when they talk about experiments designed to test the theory of evolution. It is not testable. They may happen to stumble across facts which would seem to conflict with its predictions. These facts will invariably be ignored and their discoverers will undoubtedly be deprived of continuing research grants.”
-Professor Whitten (Professor of Genetics), University of Melbourne, Australia, 1980 Assembly Week address.
“The only contribution of thermodynamics to theoretical biology is absolute negation of automatic commencement or automatic maintenance of life.”
-Lord Kelvin, “On the Age of the Sun’s Heat,” Popular Lectures and Addresses (London: Macmillan, 1889), p. 415.
“The theory of evolution… presents only fallacious solutions to the problem of the nature of evolutionary transformations… perhaps we are now in a worse position than in 1859 because we have searched for one century and we have the impression that the different hypotheses are now exhausted. Presently, nature appears to be more steady, more firm and more refractory to changes than we thought… The world supposed by transformation is a phantasmagoric, surrealistic world… Personally I believe this phantasmagoria has existed before the calm and stable reality that we now observe in the nature.”
-Jean Rostand, 1972, quoted in J. Garrido: “Evolution and Molecular Biology,” Creation Research Society Quarterly, 10 (1973): 168.
“To improve a living organism by random mutation is like saying you could improve a Swiss watch by dropping it and bending one of its wheels or axis. Improving life by random mutations has the probability of zero.”
-Albert Szent-Gyorgi, Nobel Laureate (Medicine, 1937).
“To postulate that the development and survival of the fittest is entirely a consequence of chance mutations seems to me a hypothesis based on no evidence and irreconcilable with the facts. These classical evolutionary theories are a gross over-simplification of an immensely complex and intricate mass of facts, and it amazes me that they are swallowed so uncritically and readily, and for such a long time, by so many scientists without a murmur of protest.”
-Sir Ernst B. Chain, Nobel Laureate (Medicine, 1945).
“It’s such a deeply ingrained faith, such a strong dogma on which we are all raised from an early age. Interestingly, I’ve read a number of biographies of scientists who are leaders in both creationist and evolutionary thought. The overwhelming trend is that the leaders of evolutionary thought all make their living purely from evolutionary theory. They are ‘specialists in evolution’ and there is no way that you could see how someone whose entire life and reputation and livelihood were bound up with the theory could turn against it. On the other hand, the leaders of the creationist movement usually have made a name for themselves in some area of fundamental and applied science — real science — before moving into creation science.”
-Kouznetsov, in Dr. Carl Wieland, “Interview with Dr. Dmitri Kouznetsov,” Creation Ex Nihilo, Vol. 14, No. 1, p. 36.
“Nine-tenths of the talk of evolutionists is sheer nonsense, not founded on observation and wholly unsupported by facts. This museum is full of proofs of the utter falsity of their views. In all this great museum, there is not a particle of evidence of the transmutation of species.”
-Dr. Etheridge, senior paleontologist of the British Museum of Natural History, cited in Dr. Scott Huse, The Collapse of Evolution.
“…contrary to what is widely assumed by evolutionary biologists today, it has always been the anti-evolutionists, not the evolutionists, in the scientific community who have stuck rigidly to the facts and adhered to a more strictly empirical approach.”
-Dr. Michael Denton, Evolution: A Theory in Crisis (London: Burnett Books, 1985), p. 353, 354. (Note: Dr. Denton is neither a creationist nor a Christian.)
Most of these arguments are complete misrepresentations of what evolution is about. We don’t expect to see half form eyes in the evolutionary history.
Of course a human eye cut in half will not work, but nobody says we evolved from half a human eye. Nobody claims that the human eye spontaneously came into existence, either. There are several forms of less sophisticated eyes. There are also forms of eyes that are better designs than human ones. You certainly can’t say that the human eye is of perfect design when we have an unnecessary blind spot! (The argument against that has often been that God gave us the blind spot to remind us that we do not see all—but then you’re taking both perfection and imperfection as proof of the same thing and completely invalidate your logic.)
We don’t have cat like senses because we didn’t evolve from cats. The selection pressures on our development just haven’t been such to require it. In fact we actually used to have much better vision (there are intricately detailed ancient pieces of art to demonstrate this) but since we domesticated animals and began agriculture, humans haven’t needed as good vision as they did when out hunting. As a result the average person today has very poor vision.
Likely all the criticisms of evolution Gunawan quoted could be applied equally well to Creationism. Refutation of one is not proof of the other, after all. But I do note one thing—Lord Kelvin’s mention of thermodynamics making evolution impossible is incorrect. It no more makes evolution impossible than growing from a baby to an adult.
When I first came across “Atlas of Creation”, it was not available for free. If this is the case now then I would read it, just as I read Behe’s “Darwin’s Black Box” in response to Dawkins’s book.
For GP: My friend, I’m not asking you to believe in creation…. I just need you to be a sincere scientific when you talk about the “evolution” “theory”. I also want you, after you will reject this dogma, to stay as scientific as always with all other options and theories including the creation theory and the existence of God.
Regarding your last reply you always hide, as all evolutionists do, behind vague and impossible to prove statements like “The selection pressures”
“There are several forms of less sophisticated eyes” “we actually used to have much better vision” “humans haven’t needed as good vision as they did when out hunting”. All these quotes from your last reply have to do more with guesses and unfounded theories than anything else.
Let me know what do you think after reading the atlas of creation. If you can’t find it free online let me know.
Even one single protein to emerge by coincidences is imposs?ible, refutes whole theory of evolution. The odds of a single protein with 500 aminoa acids to emerge by chance as the theory of evolution claims is, 1 ,n 10 950. This number is 950 zeros next to number 1. So it is impossible. After that it doesn’t make any sense to take some skull fractures and engage into speculation whether humans evolved from apes etc. Because if you shown any one step of evolution is impossible you basicaly invalidate whole theory of evolutio. Darwnism is an outdated dogma of 19 th century.
If you think evolution says that complete protein with 500 amino acids assembled spontaneously out of some primordial soup, then you clearly don’t understand evolution at all. Natural selection operates through small cumulative changes, as I think has likely been mentioned in this thread already.
GP said that “Natural selection operates through small cumulative changes”, I’m just wondering if these cumulative changes never lead to “a dead end”. To explain my point, in order for the changes to be cumulative, the first change should be “upgradable” to the second change, and the second change should be “upgradable” to the third change and so on. And we are talking here about millions of small changes!!!! In other words, the first change should have in perspective all the upcoming changes to avoid reaching a Dead End….I really doubt that this could be done without any design.
There’s always a chance something will change, so in that sense there’s no dead ends. However, there are dead ends in that a species might not change fast enough to adapt to changing circumstances and go extinct, for example. Or a species might just stay the same, like sturdy little cockroaches.
There’s another subtle point, though, that since species which are able to adapt quickly (due for example to lots of variation in the population or a flexible genome) will survive, natural selection favours species which can evolve.
Unfortunately, GP, you didn’t get my point about the “dead end” in evolution. I need you to explain the “upgradable” side of it that you didn’t mention. For example, if an evolution happens to something and we got to point A. In other word the first evolution lead to point A. Now for the specie to go from this point A to the second point B it should have the “abilities” and be “prepared” to “receive” the second evolution that lead to point B. This is only possible if the evolution that happened in point A knew that another evolution is going to happen and prepare for it. To give you a concrete example, if our specie evolved to a “helmet” in the first phase, this specie can’t evolve to a “car” in the second evolution phase. This is because it is not prepared for it.
In summary, for the second evolution to happen it needs to be expected by the first one. And for the third evolution to happen it needs to be expected by the second one and so on…. I hope I made it clear this time…
If there’s no way for something to undergo a particular small change, then it won’t undergo that change. That’s true. But that doesn’t mean that all changes are impossible. Mutations can always happen, so changes can always happen, and things will change into things that they can change into. Evolution is just a buildup of all these small changes over billions of years.
For GP.
I think you should re-read what I wrote before since you look as if you didn’t get my point. Or, to be more accurate, I feel that you got it but only partially. Good luck with your thinking and I hope that your mind and heart will be more open in the future to accept and admit that you were wrong.